I was going to give a pass to the discussion of information (specified or otherwise) in the hopes that Meyer will more fully discuss this later on in the book. I have little hope for this though. So… The terms and such that are used by ID proponents are extremely wishy-washy and, to date, no one has ever calculated (or even shown how to calculate) the information (specified or otherwise) in any living thing, protein, or DNA sequence.
You see, the problem for ID is simple. Calculating the information content of a string of text is really trivial. And DNA and proteins can be broken down into a string of text (4 nucleotides or 20 amino acids). The problem is that this doesn’t tell us anything. Information content doesn’t talk about the function. For example
ACCGATCGTACGTACGTAGCTAGCTAGTCGATCGTACGTGCATGCTA
and
ACCGATCGTACGTACGTAGCTAGCTAGTCGAACGTACGTGCATGCTA
have exactly the same amount of information. The only difference is the bolded nucleotide in the lower one. The problem is that the information content doesn’t tell us whether that bolded nucleotide makes a difference to the resulting protein (or whatever that DNA sequence does).
So we have to get into the FUNCTION of the DNA sequence and that’s something that no one has been able to quantify yet. Does that single change make the protein (or control sequence) non-functional? Does it make it better? Does it do nothing? Does it make the system do something else entirely?
And once you find out what that change does, how do you quantify it?
That’s what ID lacks. Everyone knows that, in terms of straight information, those two sequences are the same. But the ID proponents can’t calculate or determine “specified” or “functional” and that’s their big problem.
How can Meyer say
No undirected physical or chemical process has demonstrated the capacity to produce specified information starting “from purely physical or chemical” precursors
When he has no idea what “specified information” is in the first place.
I’ll point out here that physical and chemical processes covers the entirety of the universe. So, according to Meyer, the only thing that can create this specified information is beyond the natural universe… that is, the supernatural.
Meyer goes on to talk about how in Signature in the Cell, he says that something can create this specified information… intelligence. Of course, he has never done any research on this. He assumes this. And that’s a major problem with ID. They assume what they are trying to prove.
Until they actually define specified information and start to calculate it and give the requirements for non-intelligence produced information and intelligent produced information, then the discussion of information is a waste of time.
Meyer gives us a list of the things that have “functional information” a new word that he doesn’t define. That list is: “embedded in a radio signal, carved in a stone monument, etched on a magnetic disk, produced by a scientist.”
Anyone want to guess the difference between those things and life? Something that Meyer and the others don’t talk about. Something called inexact reproduction…
Meyer might have heard about this concept in his high school biology class. It’s pretty simple. Organisms can reproduce. Radio signals, sculptures, computer programs can’t. Well, actually computer programs can… sort of. But what’s fascinating is that this entire field of reproducible software is called evolutionary programming and is one of the richest and most valuable fields of computer science. Evolutionary algorithms have produced results that intelligence HAS NOT BEEN ABLE TO.
And that’s a devastating response to intelligent design. Very simply, using evolutionary principles has resulted in systems that intelligence can’t even explain, much less reproduce.
One last note. Meyer makes a fundamental mistake when discussing the origins of life. He assumes that early life on Earth must be exactly like life is now. With DNA and RNA and ATP and enzymes and ribozomes and all that kind of thing. He says, and rightly so, that there’s no way to go from base compounds to modern living systems. He’s right.
It’s a good thing that is not how scientists think it happened. I provided some evidence in the previous installment. Origins of life is a huge field of research, hundreds of papers are published in the field annually. And so far, not a single one has said “this result makes it impossible”. Indeed, there are often multiple pathways to get to certain chemicals. And once you have certain chemicals, then they will combine, even if randomly and we’ve seen that even very, very short ribozymes can act as catalysts.
Is that a just so story… kind of, but it’s backed up by 60 years of research data. It could happen.
ID doesn’t even have that yet.
