In my weaknesses of evolution series, a creationist made the claim that
ID theory is about design detection. Establishing who or what the designer is, and how it accomplished what it did are avenues of investigation that can only be embarked upon **after** one has reliably detected design. They are **subsequent**, ancillary investigations that first require the detection of design. However, who/what the designer is, and how they accomplished the task, are different kinds of investigations.
That’s very interesting. I freely admit that this is a good description of ID, since the modern ID groups strictly prohibit discussion of the designer.
ID is about detecting design.
Here’s the challenge. Can any ID proponent detect design?
Below, I have two RNA sequences. One is designed. We know it’s designed because a human designed it. The other one is completely random. Meaningless garbage. Because I randomly selected nucleotide letters.
GGUUCAUGUGCUCGAUUGUUACGUAAGUAAGUAACAGUUUGAAUGGGUUGAAGAAU
UUCAAUAGGAAUUGUACAUAUUAGAGGAAUUUCUAUCAGUACUUAAAGUUUAGAUG
There’s the challenge. ID proponents, post your answer (which is designed? top or bottom) and why you think so. What ID principles did you use to determine design?
Alternately, you can explain to me, in detail, how to determine design, when given data like this and I’ll have someone else do this. Be sure to explain your process in detail so that I (and others) can use it.
Don’t be afraid of high-end math if need be. I sit in an office with a dozen or so mathematicians (about half of which have graduate degrees) and I can pick up the phone and call on a half dozen people with doctorate degrees in statistics. Don’t be afraid to discuss things in detail.
Why is this important?
It’s pretty simple. If the ID proponent cannot tell the difference between a designed object and a random object, then how can they possibly tell the difference between a designed object and an evolved object.
The last time I issued this challenge, I got a total of one response. That ID proponent simply said that this was not important to the study of ID and something about function.
So, let me assure the ID proponents, that the designed RNA sequence has a function. A very specific function.
So, let’s hear it.
If anyone else wants to play too, then have at it.
